Regulon of SoxR in Aeromonas salmonicida subsp. salmonicida A449
| Regulator type: | Transcription factor |
| TF locus tag: | ASA_1663 |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Psychromonadaceae/Aeromonadales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -55
Score: 5.3 Sequence: ACCTCAAGTTAGCTTTAACT
Locus tag: ASA_1662
Name: null Funciton: hypothetical protein |
|||
|
hypothetical protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |