Profile of regulator SoxR in Psychromonadaceae/Aeromonadales
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Psychromonadaceae/Aeromonadales |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Moritella sp. PE36 | |||||
| PE36_09311 | PF07690 | -141 | 6.4 | ACCTCAACATAACTTGAGGT | |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | |||||
| AHA_2711 | null | -61 | 5.3 | ACCTCAAGTTAGCTTTAACT | |
| Aeromonas salmonicida subsp. salmonicida A449 | |||||
| ASA_1662 | null | -55 | 5.3 | ACCTCAAGTTAGCTTTAACT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |