Regulon of SoxR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_09316
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 6.4 Sequence: ACCTCAACATAACTTGAGGT Locus tag: PE36_09311 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	PE36_09311	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD