Regulog SMb20667 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | 5 | 2 |
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 5 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 6 | 2 |
| Rhizobium sp. NGR234 | 6 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 5 | 2 |
| Xanthobacter autotrophicus Py2 | 6 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SMb20667 |
|
*
Azorhizobium caulinodans ORS 571 Site: position = -2 score = 6.61902 sequence = TTTTGGCAGCGCTGCCATTT Site: position = -58 score = 6.61902 sequence = TTTTGGCAGCGCTGCCATTT Gene: AZC_2778: Putative transcriptional regulator SMb20667, LacI family |
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -310 score = 6.59375 sequence = TTTTGGCAGCGCTGCCATTC Site: position = -256 score = 6.61902 sequence = AAATGGCAGCGCTGCCAAAA Gene: RHE_PF00344: Putative transcriptional regulator SMb20667, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -200 score = 6.59375 sequence = TTTTGGCAGCGCTGCCATTC Site: position = -169 score = 6.54869 sequence = TTTTGGCAGCGCTGCCAACG Site: position = -146 score = 6.50884 sequence = AATTGGTAGCGCTGCCAAAA Gene: pRL120618: Putative transcriptional regulator SMb20667, LacI family |
*
Rhizobium sp. NGR234 Site: position = -161 score = 6.35756 sequence = AGATGGCAGCGCTGCCATTA Site: position = -129 score = 6.37894 sequence = GTTTGGCAGCGCTGCCAAGT Site: position = -106 score = 6.50884 sequence = AATTGGTAGCGCTGCCAAAA Gene: NGR_b20310: Putative transcriptional regulator SMb20667, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -81 score = 6.50884 sequence = AATTGGTAGCGCTGCCAAAA Site: position = -103 score = 6.4508 sequence = CTTTGGCAGCGCTGCCAACC Gene: SMb20667: Putative transcriptional regulator SMb20667, LacI family |
*
Xanthobacter autotrophicus Py2 Site: position = -155 score = 6.38939 sequence = AAATGGTAGCGCTGCCAAAA Site: position = -210 score = 6.07063 sequence = GCATGGCAGCGCTGCCATCA Site: position = -178 score = 6.18486 sequence = CAGTGGCAGCGCTGCCAAAC Gene: Xaut_1029: Putative transcriptional regulator SMb20667, LacI family |
Putative transcriptional regulator SMb20667, LacI family |
| ygbL |
|
Gene: AZC_2779: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
|
|
|
|
|
|
|
Gene: RHE_PF00343: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
Gene: pRL120619: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
Gene: NGR_b20300: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
|
Gene: SMb20666: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
Gene: Xaut_1030: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases |
| CRON 2. | ||||||||||||||||
| COG2271 |
|
|
|
|
|
|
|
|
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -56 score = 6.50884 sequence = TTTTGGCAGCGCTACCAATT Site: position = -33 score = 6.54869 sequence = CGTTGGCAGCGCTGCCAAAA Gene: pRL120617: Putative sugar acid transporter, MFS family |
*
Rhizobium sp. NGR234 Site: position = -136 score = 6.50884 sequence = TTTTGGCAGCGCTACCAATT Site: position = -113 score = 6.37894 sequence = ACTTGGCAGCGCTGCCAAAC Site: position = -81 score = 6.35756 sequence = TAATGGCAGCGCTGCCATCT Gene: NGR_b20320: Putative sugar acid transporter, MFS family |
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -131 score = 6.38939 sequence = TTTTGGCAGCGCTACCATTT Site: position = -108 score = 6.18486 sequence = GTTTGGCAGCGCTGCCACTG Site: position = -76 score = 6.07063 sequence = TGATGGCAGCGCTGCCATGC Gene: Xaut_1028: Putative sugar acid transporter, MFS family |
Putative sugar acid transporter, MFS family |
| ygbJ |
|
*
Azorhizobium caulinodans ORS 571 Site: position = -125 score = 6.61902 sequence = AAATGGCAGCGCTGCCAAAA Site: position = -69 score = 6.61902 sequence = AAATGGCAGCGCTGCCAAAA Gene: AZC_2777: 3-hydroxyacid dehydrogenase/reductase |
|
Gene: blr2928: 3-hydroxyacid dehydrogenase/reductase |
Gene: BBta_2897: 3-hydroxyacid dehydrogenase/reductase |
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -99 score = 6.61902 sequence = TTTTGGCAGCGCTGCCATTT Site: position = -45 score = 6.59375 sequence = GAATGGCAGCGCTGCCAAAA Gene: RHE_PF00345: 3-hydroxyacid dehydrogenase/reductase |
Gene: pRL120616: 3-hydroxyacid dehydrogenase/reductase |
Gene: NGR_b20330: 3-hydroxyacid dehydrogenase/reductase |
|
*
Sinorhizobium meliloti 1021 Site: position = -81 score = 6.50884 sequence = TTTTGGCAGCGCTACCAATT Site: position = -59 score = 6.4508 sequence = GGTTGGCAGCGCTGCCAAAG Gene: SMb20668: 3-hydroxyacid dehydrogenase/reductase |
Gene: Xaut_1027: 3-hydroxyacid dehydrogenase/reductase |
3-hydroxyacid dehydrogenase/reductase |
| ygbM |
|
Gene: AZC_2776: Hydroxypyruvate isomerase (EC 5.3.1.22) |
|
Gene: blr2929: Hydroxypyruvate isomerase (EC 5.3.1.22) |
Gene: BBta_2898: Hydroxypyruvate isomerase (EC 5.3.1.22) |
|
|
|
|
Gene: RHE_PF00346: Hydroxypyruvate isomerase (EC 5.3.1.22) |
Gene: pRL120615: Hydroxypyruvate isomerase (EC 5.3.1.22) |
Gene: NGR_b20340: Hydroxypyruvate isomerase (EC 5.3.1.22) |
|
Gene: SMb20669: Hydroxypyruvate isomerase (EC 5.3.1.22) |
Gene: Xaut_1026: Hydroxypyruvate isomerase (EC 5.3.1.22) |
Hydroxypyruvate isomerase (EC 5.3.1.22) |
| ygbK |
|
Gene: AZC_2775: Uncharacterized protein conserved in bacteria |
|
Gene: blr2930: Uncharacterized protein conserved in bacteria |
Gene: BBta_2899: Uncharacterized protein conserved in bacteria |
|
|
|
|
Gene: RHE_PF00347: Uncharacterized protein conserved in bacteria |
Gene: pRL120614: Uncharacterized protein conserved in bacteria |
Gene: NGR_b20350: Uncharacterized protein conserved in bacteria |
|
Gene: SMb20670: Uncharacterized protein conserved in bacteria |
Gene: Xaut_1025: Uncharacterized protein conserved in bacteria |
Uncharacterized protein conserved in bacteria |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |