Regulon of SMb20667 in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_1029
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20667 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 6.4 Sequence: TTTTGGCAGCGCTACCATTT Position: -108 Score: 6.2 Sequence: GTTTGGCAGCGCTGCCACTG Position: -76 Score: 6.1 Sequence: TGATGGCAGCGCTGCCATGC Locus tag: Xaut_1028 Name: COG2271 Funciton: Putative sugar acid transporter, MFS family Locus tag: Xaut_1027 Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase Locus tag: Xaut_1026 Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22) Locus tag: Xaut_1025 Name: ygbK Funciton: Uncharacterized protein conserved in bacteria
	Xaut_1028	COG2271	Putative sugar acid transporter, MFS family
	Xaut_1027	ygbJ	3-hydroxyacid dehydrogenase/reductase
	Xaut_1026	ygbM	Hydroxypyruvate isomerase (EC 5.3.1.22)
	Xaut_1025	ygbK	Uncharacterized protein conserved in bacteria
Position: -210 Score: 6.1 Sequence: GCATGGCAGCGCTGCCATCA Position: -178 Score: 6.2 Sequence: CAGTGGCAGCGCTGCCAAAC Position: -155 Score: 6.4 Sequence: AAATGGTAGCGCTGCCAAAA Locus tag: Xaut_1029 Name: SMb20667 Funciton: Putative transcriptional regulator SMb20667, LacI family Locus tag: Xaut_1030 Name: ygbL Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
	Xaut_1029	SMb20667	Putative transcriptional regulator SMb20667, LacI family
	Xaut_1030	ygbL	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD