Regulon of SMb20667 in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_PF00344
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20667 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 6.6 Sequence: TTTTGGCAGCGCTGCCATTT Position: -45 Score: 6.6 Sequence: GAATGGCAGCGCTGCCAAAA Locus tag: RHE_PF00345 Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase Locus tag: RHE_PF00346 Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22) Locus tag: RHE_PF00347 Name: ygbK Funciton: Uncharacterized protein conserved in bacteria
	RHE_PF00345	ygbJ	3-hydroxyacid dehydrogenase/reductase
	RHE_PF00346	ygbM	Hydroxypyruvate isomerase (EC 5.3.1.22)
	RHE_PF00347	ygbK	Uncharacterized protein conserved in bacteria
Position: -310 Score: 6.6 Sequence: TTTTGGCAGCGCTGCCATTC Position: -256 Score: 6.6 Sequence: AAATGGCAGCGCTGCCAAAA Locus tag: RHE_PF00344 Name: SMb20667 Funciton: Putative transcriptional regulator SMb20667, LacI family Locus tag: RHE_PF00343 Name: ygbL Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
	RHE_PF00344	SMb20667	Putative transcriptional regulator SMb20667, LacI family
	RHE_PF00343	ygbL	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD