Regulon of SMb20667 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b20310
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20667 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 6.5 Sequence: TTTTGGCAGCGCTACCAATT Position: -113 Score: 6.4 Sequence: ACTTGGCAGCGCTGCCAAAC Position: -81 Score: 6.4 Sequence: TAATGGCAGCGCTGCCATCT Locus tag: NGR_b20320 Name: COG2271 Funciton: Putative sugar acid transporter, MFS family Locus tag: NGR_b20330 Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase Locus tag: NGR_b20340 Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22) Locus tag: NGR_b20350 Name: ygbK Funciton: Uncharacterized protein conserved in bacteria
	NGR_b20320	COG2271	Putative sugar acid transporter, MFS family
	NGR_b20330	ygbJ	3-hydroxyacid dehydrogenase/reductase
	NGR_b20340	ygbM	Hydroxypyruvate isomerase (EC 5.3.1.22)
	NGR_b20350	ygbK	Uncharacterized protein conserved in bacteria
Position: -161 Score: 6.4 Sequence: AGATGGCAGCGCTGCCATTA Position: -129 Score: 6.4 Sequence: GTTTGGCAGCGCTGCCAAGT Position: -106 Score: 6.5 Sequence: AATTGGTAGCGCTGCCAAAA Locus tag: NGR_b20310 Name: SMb20667 Funciton: Putative transcriptional regulator SMb20667, LacI family Locus tag: NGR_b20300 Name: ygbL Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
	NGR_b20310	SMb20667	Putative transcriptional regulator SMb20667, LacI family
	NGR_b20300	ygbL	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD