Regulon of SMb20667 in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_2778
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20667 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.6 Sequence: AAATGGCAGCGCTGCCAAAA Position: -69 Score: 6.6 Sequence: AAATGGCAGCGCTGCCAAAA Locus tag: AZC_2777 Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase Locus tag: AZC_2776 Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22) Locus tag: AZC_2775 Name: ygbK Funciton: Uncharacterized protein conserved in bacteria
	AZC_2777	ygbJ	3-hydroxyacid dehydrogenase/reductase
	AZC_2776	ygbM	Hydroxypyruvate isomerase (EC 5.3.1.22)
	AZC_2775	ygbK	Uncharacterized protein conserved in bacteria
Position: -58 Score: 6.6 Sequence: TTTTGGCAGCGCTGCCATTT Position: -2 Score: 6.6 Sequence: TTTTGGCAGCGCTGCCATTT Locus tag: AZC_2778 Name: SMb20667 Funciton: Putative transcriptional regulator SMb20667, LacI family Locus tag: AZC_2779 Name: ygbL Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
	AZC_2778	SMb20667	Putative transcriptional regulator SMb20667, LacI family
	AZC_2779	ygbL	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD