Regulog SocR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Santhopine utilization |
| Effector: | Mannopine; Deoxyfructosyl glutamine |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Mannopine
- By effector - Deoxyfructosyl glutamine
- By pathway - Santhopine utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 5 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 4 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 4 | 2 |
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| socA |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -141 score = 6.0005 sequence = CATTGAGACCGGTCTCAGTA Site: position = -162 score = 6.2698 sequence = CAAAGAGACCGGTCTCATTC Gene: Atu5006: Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -105 score = 5.39161 sequence = ATTGGAGACCGGTATCATTG Site: position = -126 score = 5.95688 sequence = TCGTGAGACCGGTCTCTTTT Gene: RHE_PF00255: Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -104 score = 5.43642 sequence = ATCAGAGACCGGTATCTTGT Site: position = -125 score = 6.1339 sequence = TTGTGAGACCGGTCTCTTTA Gene: pRL120733: Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein |
|
|
|
|
Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein |
| socB |
Gene: Atu5005: Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component |
|
|
|
|
|
|
|
|
Gene: RHE_PF00254: Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component |
Gene: pRL120734: Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component |
|
|
|
|
Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component |
| socC |
Gene: Atu5004: NAD-depending oxidoreductase involved in deoxyfructosyl glutamine utilization |
|
|
|
|
|
|
Gene: Meso_4517: NAD-depending oxidoreductase involved in deoxyfructosyl glutamine utilization |
|
|
|
|
|
|
|
NAD-depending oxidoreductase involved in deoxyfructosyl glutamine utilization |
| socD |
Gene: Atu5003: Fructosyl-amino acid oxidase (EC 1.5.3.-) |
|
|
|
|
|
|
|
|
Gene: RHE_PF00253: Fructosyl-amino acid oxidase (EC 1.5.3.-) |
Gene: pRL120735: Fructosyl-amino acid oxidase (EC 1.5.3.-) |
|
|
|
|
Fructosyl-amino acid oxidase (EC 1.5.3.-) |
| CRON 2. | ||||||||||||||||
| socR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -104 score = 6.0005 sequence = TACTGAGACCGGTCTCAATG Site: position = -83 score = 6.2698 sequence = GAATGAGACCGGTCTCTTTG Gene: Atu5007: Santhopine catabolism transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -96 score = 5.39161 sequence = CAATGATACCGGTCTCCAAT Site: position = -75 score = 5.95688 sequence = AAAAGAGACCGGTCTCACGA Gene: RHE_PF00256: Santhopine catabolism transcriptional regulator, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -76 score = 6.1339 sequence = TAAAGAGACCGGTCTCACAA Site: position = -97 score = 5.43642 sequence = ACAAGATACCGGTCTCTGAT Gene: pRL120732: Santhopine catabolism transcriptional regulator, LacI family |
|
|
|
|
Santhopine catabolism transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |