Regulon of SocR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	pRL120732
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Santhopine utilization
Effector:	Mannopine; Deoxyfructosyl glutamine
Regulog:	SocR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Mannopine
By effector - Deoxyfructosyl glutamine
By pathway - Santhopine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.4 Sequence: ACAAGATACCGGTCTCTGAT Position: -76 Score: 6.1 Sequence: TAAAGAGACCGGTCTCACAA Locus tag: pRL120732 Name: socR Funciton: Santhopine catabolism transcriptional regulator, LacI family
	pRL120732	socR	Santhopine catabolism transcriptional regulator, LacI family
Position: -125 Score: 6.1 Sequence: TTGTGAGACCGGTCTCTTTA Position: -104 Score: 5.4 Sequence: ATCAGAGACCGGTATCTTGT Locus tag: pRL120733 Name: socA Funciton: Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein Locus tag: pRL120734 Name: socB Funciton: Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component Locus tag: pRL120735 Name: socD Funciton: Fructosyl-amino acid oxidase (EC 1.5.3.-)
	pRL120733	socA	Deoxyfructosyl glutamine and mannopine ABC transporter, periplasmic amino acid-binding protein
	pRL120734	socB	Deoxyfructosyl glutamine and mannopine ABC transporter, ATP-binding protein fused to permease component
	pRL120735	socD	Fructosyl-amino acid oxidase (EC 1.5.3.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD