Regulog GntR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 5 | 1 |
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | 5 | 1 |
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | 3 | 3 |
| Reinekea sp. MED297 | ||
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| gntU |
|
|
|
|
|
|
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -107 score = 6.2674 sequence = GAATGTTACCGGTAACATTC Site: position = -40 score = 4.47138 sequence = CCTCGTTGCCGGTCGCGCCT Gene: Csal_0925: Low-affinity gluconate transporter |
|
|
Low-affinity gluconate transporter |
| CRON 2. | |||||||||||||
| gntX |
*
Hahella chejuensis KCTC 2396 Site: position = -129 score = 5.63238 sequence = AAAAGTTACCGGTAACAAAT Site: position = -103 score = 5.97956 sequence = GAATGTTACCGGTAACACGC Gene: HCH_03539: Predicted gluconate TRAP family transporter, DctP subunit |
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -123 score = 5.62373 sequence = AAATGTTATCGGTAACATCA Site: position = -100 score = 5.65655 sequence = TCTAGTTACCGGTAACATTT Gene: Mmwyl1_0698: Predicted gluconate TRAP family transporter, DctP subunit |
|
|
|
|
Gene: MED297_18002: Predicted gluconate TRAP family transporter, DctP subunit |
|
Predicted gluconate TRAP family transporter, DctP subunit |
| gntY |
Gene: HCH_03541: Predicted gluconate TRAP family transporter, DctQ subunit |
|
|
|
|
Gene: Mmwyl1_0697: Predicted gluconate TRAP family transporter, DctQ subunit |
|
|
|
|
Gene: MED297_17997: Predicted gluconate TRAP family transporter, DctQ subunit |
|
Predicted gluconate TRAP family transporter, DctQ subunit |
| gntZ |
Gene: HCH_03542: Predicted gluconate TRAP family transporter, DctM subunit |
|
|
|
|
Gene: Mmwyl1_0696: Predicted gluconate TRAP family transporter, DctM subunit |
|
|
|
|
Gene: MED297_17992: Predicted gluconate TRAP family transporter, DctM subunit |
|
Predicted gluconate TRAP family transporter, DctM subunit |
| gntK |
Gene: HCH_03543: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
|
Gene: Mmwyl1_0695: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -69 score = 4.47138 sequence = AGGCGCGACCGGCAACGAGG Gene: Csal_0926: Thermoresistant gluconokinase (EC 2.7.1.12) |
Gene: MED297_17987: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gntR |
Gene: HCH_03544: Gluconate utilization transcriptional regulator GntR, LacI family |
|
|
|
|
Gene: Mmwyl1_0694: Gluconate utilization transcriptional regulator GntR, LacI family |
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -53 score = 5.55038 sequence = GAACGTTACCGCTAACATCG Gene: Csal_0927: Gluconate utilization transcriptional regulator GntR, LacI family |
Gene: MED297_17972: Gluconate utilization transcriptional regulator GntR, LacI family |
|
Gluconate utilization transcriptional regulator GntR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |