Regulog GntR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	5	1
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1	5	1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043	3	3
Reinekea sp. MED297
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
gntU	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	* Chromohalobacter salexigens DSM 3043 Site: position = -107 score = 6.2674 sequence = GAATGTTACCGGTAACATTC Site: position = -40 score = 4.47138 sequence = CCTCGTTGCCGGTCGCGCCT Gene: Csal_0925: Low-affinity gluconate transporter	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Low-affinity gluconate transporter

CRON 2.
gntX	* Hahella chejuensis KCTC 2396 Site: position = -129 score = 5.63238 sequence = AAAAGTTACCGGTAACAAAT Site: position = -103 score = 5.97956 sequence = GAATGTTACCGGTAACACGC Gene: HCH_03539: Predicted gluconate TRAP family transporter, DctP subunit	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -123 score = 5.62373 sequence = AAATGTTATCGGTAACATCA Site: position = -100 score = 5.65655 sequence = TCTAGTTACCGGTAACATTT Gene: Mmwyl1_0698: Predicted gluconate TRAP family transporter, DctP subunit	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_18002: Predicted gluconate TRAP family transporter, DctP subunit	Alcanivorax borkumensis SK2	Predicted gluconate TRAP family transporter, DctP subunit
gntY	Hahella chejuensis KCTC 2396 Gene: HCH_03541: Predicted gluconate TRAP family transporter, DctQ subunit	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_0697: Predicted gluconate TRAP family transporter, DctQ subunit	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_17997: Predicted gluconate TRAP family transporter, DctQ subunit	Alcanivorax borkumensis SK2	Predicted gluconate TRAP family transporter, DctQ subunit
gntZ	Hahella chejuensis KCTC 2396 Gene: HCH_03542: Predicted gluconate TRAP family transporter, DctM subunit	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_0696: Predicted gluconate TRAP family transporter, DctM subunit	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_17992: Predicted gluconate TRAP family transporter, DctM subunit	Alcanivorax borkumensis SK2	Predicted gluconate TRAP family transporter, DctM subunit
gntK	Hahella chejuensis KCTC 2396 Gene: HCH_03543: Thermoresistant gluconokinase (EC 2.7.1.12)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_0695: Thermoresistant gluconokinase (EC 2.7.1.12)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	* Chromohalobacter salexigens DSM 3043 Site: position = -69 score = 4.47138 sequence = AGGCGCGACCGGCAACGAGG Gene: Csal_0926: Thermoresistant gluconokinase (EC 2.7.1.12)	Reinekea sp. MED297 Gene: MED297_17987: Thermoresistant gluconokinase (EC 2.7.1.12)	Alcanivorax borkumensis SK2	Thermoresistant gluconokinase (EC 2.7.1.12)
gntR	Hahella chejuensis KCTC 2396 Gene: HCH_03544: Gluconate utilization transcriptional regulator GntR, LacI family	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_0694: Gluconate utilization transcriptional regulator GntR, LacI family	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	* Chromohalobacter salexigens DSM 3043 Site: position = -53 score = 5.55038 sequence = GAACGTTACCGCTAACATCG Gene: Csal_0927: Gluconate utilization transcriptional regulator GntR, LacI family	Reinekea sp. MED297 Gene: MED297_17972: Gluconate utilization transcriptional regulator GntR, LacI family	Alcanivorax borkumensis SK2	Gluconate utilization transcriptional regulator GntR, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog GntR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --