Regulon of GntR in Marinomonas sp. MWYL1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmwyl1_0694
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 5.6 Sequence: AAATGTTATCGGTAACATCA Position: -100 Score: 5.7 Sequence: TCTAGTTACCGGTAACATTT Locus tag: Mmwyl1_0698 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Mmwyl1_0697 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Mmwyl1_0696 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Mmwyl1_0695 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Mmwyl1_0694 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Mmwyl1_0698	gntX	Predicted gluconate TRAP family transporter, DctP subunit
	Mmwyl1_0697	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	Mmwyl1_0696	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	Mmwyl1_0695	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Mmwyl1_0694	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD