Regulon of GntR in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_0927
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.6 Sequence: GAACGTTACCGCTAACATCG Locus tag: Csal_0927 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Csal_0927	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -107 Score: 6.3 Sequence: GAATGTTACCGGTAACATTC Position: -40 Score: 4.5 Sequence: CCTCGTTGCCGGTCGCGCCT Locus tag: Csal_0925 Name: gntU Funciton: Low-affinity gluconate transporter
	Csal_0925	gntU	Low-affinity gluconate transporter
Position: -69 Score: 4.5 Sequence: AGGCGCGACCGGCAACGAGG Locus tag: Csal_0926 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Csal_0926	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD