Regulon of GntR in Hahella chejuensis KCTC 2396

Properties
Regulator type:	Transcription factor
TF locus tag:	HCH_03544
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 5.6 Sequence: AAAAGTTACCGGTAACAAAT Position: -103 Score: 6 Sequence: GAATGTTACCGGTAACACGC Locus tag: HCH_03539 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: HCH_03541 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: HCH_03542 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: HCH_03543 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: HCH_03544 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	HCH_03539	gntX	Predicted gluconate TRAP family transporter, DctP subunit
	HCH_03541	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	HCH_03542	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	HCH_03543	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	HCH_03544	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD