Regulog HrcA - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	2	1
Caulobacter segnis ATCC 21756	2	1
Caulobacter sp. K31	2	1
Phenylobacterium zucineum HLK1	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
groS	* Caulobacter crescentus CB15 Site: position = -86 score = 7.10614 sequence = TTGGCACTCGAATGGAGCGACTGCTAA Gene: CC0686: Heat shock protein 60 family co-chaperone GroES	* Caulobacter segnis ATCC 21756 Site: position = -87 score = 7.30835 sequence = TTAGCACTCGGAGGGAGCGACTGCTAA Gene: Cseg_3693: Heat shock protein 60 family co-chaperone GroES	* Caulobacter sp. K31 Site: position = -88 score = 7.39119 sequence = TTGGCACTCGATGGGAGCGACTGCTAA Gene: Caul_4151: Heat shock protein 60 family co-chaperone GroES	2 Phenylobacterium zucineum HLK1* Gene: PHZ_p0096: Heat shock protein 60 family co-chaperone GroES Site: position = -93 score = 6.90073 sequence = TTAGCACTCAAGGGCCGAGACTGCTAA Gene: PHZ_c3181: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Caulobacter crescentus CB15 Gene: CC0685: Heat shock protein 60 family chaperone GroEL	Caulobacter segnis ATCC 21756 Gene: Cseg_3694: Heat shock protein 60 family chaperone GroEL	Caulobacter sp. K31 Gene: Caul_4150: Heat shock protein 60 family chaperone GroEL	2 Phenylobacterium zucineum HLK1 Gene: PHZ_p0095: Heat shock protein 60 family chaperone GroEL Gene: PHZ_c3182: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --