Regulog HrcA - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 2 | 1 |
| Caulobacter segnis ATCC 21756 | 2 | 1 |
| Caulobacter sp. K31 | 2 | 1 |
| Phenylobacterium zucineum HLK1 | 2 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| groS |
*
Caulobacter crescentus CB15 Site: position = -86 score = 7.10614 sequence = TTGGCACTCGAATGGAGCGACTGCTAA Gene: CC0686: Heat shock protein 60 family co-chaperone GroES |
*
Caulobacter segnis ATCC 21756 Site: position = -87 score = 7.30835 sequence = TTAGCACTCGGAGGGAGCGACTGCTAA Gene: Cseg_3693: Heat shock protein 60 family co-chaperone GroES |
*
Caulobacter sp. K31 Site: position = -88 score = 7.39119 sequence = TTGGCACTCGATGGGAGCGACTGCTAA Gene: Caul_4151: Heat shock protein 60 family co-chaperone GroES |
*2
Phenylobacterium zucineum HLK1 Gene: PHZ_p0096: Heat shock protein 60 family co-chaperone GroES Site: position = -93 score = 6.90073 sequence = TTAGCACTCAAGGGCCGAGACTGCTAA Gene: PHZ_c3181: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: CC0685: Heat shock protein 60 family chaperone GroEL |
Gene: Cseg_3694: Heat shock protein 60 family chaperone GroEL |
Gene: Caul_4150: Heat shock protein 60 family chaperone GroEL |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_p0095: Heat shock protein 60 family chaperone GroEL Gene: PHZ_c3182: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |