Regulon of HrcA in Phenylobacterium zucineum HLK1
| Regulator type: | Transcription factor |
| TF locus tag: | PHZ_c3470 |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Regulog: | HrcA - Caulobacterales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -93
Score: 6.9 Sequence: TTAGCACTCAAGGGCCGAGACTGCTAA
Locus tag: PHZ_c3181
Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: PHZ_c3182
Name: groL Funciton: Heat shock protein 60 family chaperone GroEL |
|||
|
groS
|
Heat shock protein 60 family co-chaperone GroES
|
||
|
groL
|
Heat shock protein 60 family chaperone GroEL
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |