Regulon of HrcA in Caulobacter segnis ATCC 21756
Regulator type: | Transcription factor |
TF locus tag: | Cseg_4005 |
Regulator family: | HrcA |
Regulation mode: | repressor |
Biological process: | Heat shock response |
Effector: | Heat shock |
Regulog: | HrcA - Caulobacterales |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
Locus Tag | Name | Function | |
---|---|---|---|
Position: -87
Score: 7.3 Sequence: TTAGCACTCGGAGGGAGCGACTGCTAA
Locus tag: Cseg_3693
Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Cseg_3694
Name: groL Funciton: Heat shock protein 60 family chaperone GroEL |
|||
groS
|
Heat shock protein 60 family co-chaperone GroES
|
||
groL
|
Heat shock protein 60 family chaperone GroEL
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |