Regulog HrcA - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 3 | 2 |
| Acidovorax sp. JS42 | 3 | 2 |
| Comamonas testosteroni KF-1 | 3 | 2 |
| Delftia acidovorans SPH-1 | 3 | 2 |
| Polaromonas naphthalenivorans CJ2 | 3 | 2 |
| Polaromonas sp. JS666 | 3 | 2 |
| Rhodoferax ferrireducens DSM 15236 | 3 | 2 |
| Variovorax paradoxus S110 | 3 | 2 |
| Verminephrobacter eiseniae EF01-2 | 3 | 2 |
| Methylibium petroleiphilum PM1 | 3 | 2 |
| Leptothrix cholodnii SP-6 | 3 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| rpoH |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -57 score = 6.54908 sequence = TTAGCACTCCCTCCAAGAGACTGCTAA Gene: Aave_3894: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Acidovorax sp. JS42 Site: position = -28 score = 6.97499 sequence = TTAGCACTCTCTCCAATGGAGTGCTAA Gene: Ajs_3522: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Comamonas testosteroni KF-1 Site: position = -28 score = 6.83008 sequence = TTAGCACTCTCTCTAACGGAGTGCTAA Gene: CtesDRAFT_2864: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Delftia acidovorans SPH-1 Site: position = -57 score = 6.99195 sequence = TTAGCACTCGGTCATAACGAGTGCTAA Gene: Daci_1694: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -57 score = 6.00645 sequence = CTGGCACTCTCTCTGATGGAGTGCTAA Gene: Pnap_0889: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Polaromonas sp. JS666 Site: position = -57 score = 6.97499 sequence = TTAGCACTCTCTCCAATGGAGTGCTAA Gene: Bpro_1256: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -58 score = 7.13299 sequence = TTAGCACTCTCTCTCATAGAGTGCTAA Gene: Rfer_1692: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Variovorax paradoxus S110 Site: position = -55 score = 6.91404 sequence = TTAGCACTCCCTCCAATCGAGTGCTAA Gene: Vapar_4379: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Verminephrobacter eiseniae EF01-2 Site: position = -72 score = 6.60359 sequence = TTGGCACTCGATCGCAGAGAGTGCTAA Gene: Veis_4476: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Methylibium petroleiphilum PM1 Site: position = -54 score = 7.17409 sequence = TTAGCACTCGTTTTACGTGAGTGCTAA Gene: Mpe_A3171: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Leptothrix cholodnii SP-6 Site: position = -59 score = 6.9416 sequence = TTAGCACTCTCGAGGGTCGAGTGCTAA Gene: Lcho_3542: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
| CRON 2. | ||||||||||||
| groS |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -123 score = 6.92309 sequence = TTAGCACTCGAAGCGGACGAGTGCTAA Gene: Aave_0946: Heat shock protein 60 family co-chaperone GroES |
*
Acidovorax sp. JS42 Site: position = -112 score = 7.20358 sequence = TTAGCACTCGAAACAGATGAGTGCTAA Gene: Ajs_0700: Heat shock protein 60 family co-chaperone GroES |
*
Comamonas testosteroni KF-1 Site: position = -111 score = 7.02817 sequence = TTAGCACTCAATGGGGTTGAGTGCTAA Gene: CtesDRAFT_4575: Heat shock protein 60 family co-chaperone GroES |
*
Delftia acidovorans SPH-1 Site: position = -114 score = 6.95003 sequence = TTAGCACTCGTTGGGCATGAGTGCTAA Gene: Daci_5660: Heat shock protein 60 family co-chaperone GroES |
*
Polaromonas naphthalenivorans CJ2 Site: position = -134 score = 6.83068 sequence = TTAGCACTCGATGAGGTGGAGTGCTAA Gene: Pnap_0658: Heat shock protein 60 family co-chaperone GroES |
*
Polaromonas sp. JS666 Site: position = -121 score = 7.19711 sequence = TTAGCACTCGATGGTATTGAGTGCTAA Gene: Bpro_0760: Heat shock protein 60 family co-chaperone GroES |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -130 score = 7.20358 sequence = TTAGCACTCGTAAGAGTTGAGTGCTAA Gene: Rfer_1132: Heat shock protein 60 family co-chaperone GroES |
*
Variovorax paradoxus S110 Site: position = -110 score = 7.021 sequence = TTAGCACTCGCTGCTGACGAGTGCTAA Gene: Vapar_1119: Heat shock protein 60 family co-chaperone GroES |
*
Verminephrobacter eiseniae EF01-2 Site: position = -110 score = 6.78183 sequence = TTAGCACTCTCCGCTGGGGAGTGCTAA Gene: Veis_2566: Heat shock protein 60 family co-chaperone GroES |
*
Methylibium petroleiphilum PM1 Site: position = -129 score = 6.26404 sequence = CTAGCACTCGCGCAGACTGAGTGCTAA Gene: Mpe_A0427: Heat shock protein 60 family co-chaperone GroES |
*
Leptothrix cholodnii SP-6 Site: position = -96 score = 6.46445 sequence = TTAGCACTCGCCGGTGGTGAGTGCTAG Gene: Lcho_0482: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: Aave_0945: Heat shock protein 60 family chaperone GroEL |
Gene: Ajs_0699: Heat shock protein 60 family chaperone GroEL |
Gene: CtesDRAFT_4574: Heat shock protein 60 family chaperone GroEL |
Gene: Daci_5661: Heat shock protein 60 family chaperone GroEL |
Gene: Pnap_0657: Heat shock protein 60 family chaperone GroEL |
Gene: Bpro_0759: Heat shock protein 60 family chaperone GroEL |
Gene: Rfer_1131: Heat shock protein 60 family chaperone GroEL |
Gene: Vapar_1118: Heat shock protein 60 family chaperone GroEL |
Gene: Veis_2567: Heat shock protein 60 family chaperone GroEL |
Gene: Mpe_A0428: Heat shock protein 60 family chaperone GroEL |
Gene: Lcho_0483: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |