Regulon of HrcA in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_0909
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -134 Score: 6.8 Sequence: TTAGCACTCGATGAGGTGGAGTGCTAA Locus tag: Pnap_0658 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Pnap_0657 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Pnap_0658	groS	Heat shock protein 60 family co-chaperone GroES
	Pnap_0657	groL	Heat shock protein 60 family chaperone GroEL
Position: -57 Score: 6 Sequence: CTGGCACTCTCTCTGATGGAGTGCTAA Locus tag: Pnap_0889 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Pnap_0889	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD