Regulog DVU0118 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | Fis |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Fis
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio vulgaris Hildenborough | 3 | 1 |
| Desulfovibrio vulgaris str. Miyazaki F | 3 | 1 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DVU0123 |
|
|
|
|
|
Gene: DESPIG_02810: membrane protein, putative |
|
*
Desulfovibrio vulgaris Hildenborough Site: position = -166 score = 6.25867 sequence = ATGTTCCCTCAAAGGAACAT Gene: DVU0123: membrane protein, putative |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -163 score = 6.44991 sequence = ATGTTCCCGAATGGGAACAT Gene: DvMF_1255: membrane protein, putative |
|
membrane protein, putative |
| DVU0122 |
|
|
|
|
|
|
|
Gene: DVU0122: hypothetical protein |
Gene: DvMF_1256: hypothetical protein |
|
hypothetical protein |
| DVU0121 |
|
|
|
|
|
|
|
Gene: DVU0121: hypothetical protein |
Gene: DvMF_1257: hypothetical protein |
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |