Regulog DVU0118 - Desulfovibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	Fis
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis

Statistics of regulated genes
Genome	Genes	Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough	3	1
Desulfovibrio vulgaris str. Miyazaki F	3	1
Lawsonia intracellularis PHE/MN1-00

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
DVU0123	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098 Gene: DESPIG_02810: membrane protein, putative	Desulfovibrio salexigens DSM 2638	* Desulfovibrio vulgaris Hildenborough Site: position = -166 score = 6.25867 sequence = ATGTTCCCTCAAAGGAACAT Gene: DVU0123: membrane protein, putative	* Desulfovibrio vulgaris str. Miyazaki F Site: position = -163 score = 6.44991 sequence = ATGTTCCCGAATGGGAACAT Gene: DvMF_1255: membrane protein, putative	Lawsonia intracellularis PHE/MN1-00	membrane protein, putative
DVU0122	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough Gene: DVU0122: hypothetical protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1256: hypothetical protein	Lawsonia intracellularis PHE/MN1-00	hypothetical protein
DVU0121	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough Gene: DVU0121: hypothetical protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1257: hypothetical protein	Lawsonia intracellularis PHE/MN1-00	hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog DVU0118 - Desulfovibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --