Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of DVU0118 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type: Transcription factor
TF locus tag: DVU0118
Regulator family: Fis
Regulation mode:
Biological process:
Effector:
Regulog: DVU0118 - Desulfovibrionales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -166
Score: 6.3
Sequence: ATGTTCCCTCAAAGGAACAT
Locus tag: DVU0123
Name: null
Funciton: membrane protein, putative
Locus tag: DVU0122
Name: null
Funciton: hypothetical protein
Locus tag: DVU0121
Name: null
Funciton: hypothetical protein
membrane protein, putative
hypothetical protein
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD