Profile of regulator DVU0118 in Desulfovibrionales
| Regulator family: | Fis |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DVU0118 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Fis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio vulgaris Hildenborough | |||||
| DVU0123 | null | -166 | 6.3 | ATGTTCCCTCAAAGGAACAT | |
| Desulfovibrio vulgaris str. Miyazaki F | |||||
| DvMF_1255 | null | -163 | 6.4 | ATGTTCCCGAATGGGAACAT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |