Regulon of DVU0118 in Desulfovibrio vulgaris str. Miyazaki F
Regulator type: | Transcription factor |
TF locus tag: | DvMF_1260 |
Regulator family: | Fis |
Regulation mode: | |
Biological process: | |
Effector: | |
Regulog: | DVU0118 - Desulfovibrionales |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Fis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -163
Score: 6.4 Sequence: ATGTTCCCGAATGGGAACAT
Locus tag: DvMF_1255
Name: null Funciton: membrane protein, putative
Locus tag: DvMF_1256
Name: null Funciton: hypothetical protein
Locus tag: DvMF_1257
Name: null Funciton: hypothetical protein |
|||
membrane protein, putative
|
|||
hypothetical protein
|
|||
hypothetical protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |