Regulon of DVU0118 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_1260
Regulator family:	Fis
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0118 - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 6.4 Sequence: ATGTTCCCGAATGGGAACAT Locus tag: DvMF_1255 Name: null Funciton: membrane protein, putative Locus tag: DvMF_1256 Name: null Funciton: hypothetical protein Locus tag: DvMF_1257 Name: null Funciton: hypothetical protein
	DvMF_1255		membrane protein, putative
	DvMF_1256		hypothetical protein
	DvMF_1257		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD