Regulog DVU0309 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - LysR
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | 2 | 2 |
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | 2 | 2 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 2 | 2 |
| Desulfovibrio vulgaris Hildenborough | 2 | 2 |
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DVU0309 |
*
Desulfohalobium retbaense DSM 5692 Site: position = -418 score = 5.34443 sequence = GCTATCAAAATTTCTGATAGG Gene: Dret_0355: transcriptional regulator, LysR family |
|
*
Desulfovibrio desulfuricans G20 Site: position = -34 score = 5.70836 sequence = TCTATCTAATTTTGTGATAGA Site: position = -67 score = 4.38809 sequence = ACTATCACATTGAGTGAGGGT Gene: Dde_0349: transcriptional regulator, LysR family |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -63 score = 5.03099 sequence = TCAATCTTTTATTCAGTTTGG Site: position = -31 score = 5.19883 sequence = ACAATCTTAAAACAAGATAGG Gene: Desal_3366: transcriptional regulator, LysR family |
*
Desulfovibrio vulgaris Hildenborough Site: position = -61 score = 5.12407 sequence = TCTATCTGGAAGACGGATTGA Site: position = -28 score = 5.73734 sequence = TCTATCTGAAAAACAGATGGA Gene: DVU0309: transcriptional regulator, LysR family |
|
|
transcriptional regulator, LysR family |
| CRON 2. | |||||||||||
| Dret_0354 |
*
Desulfohalobium retbaense DSM 5692 Site: position = -184 score = 5.34443 sequence = CCTATCAGAAATTTTGATAGC Gene: Dret_0354: peptidase M24 |
|
|
|
|
|
|
|
|
|
peptidase M24 |
| CRON 3. | |||||||||||
| COG4125 |
|
|
*
Desulfovibrio desulfuricans G20 Site: position = -213 score = 4.38809 sequence = ACCCTCACTCAATGTGATAGT Site: position = -246 score = 5.70836 sequence = TCTATCACAAAATTAGATAGA Gene: Dde_0348: membrane protein, putative |
|
|
|
*2
Desulfovibrio salexigens DSM 2638 Site: position = -52 score = 5.03099 sequence = CCAAACTGAATAAAAGATTGA Site: position = -84 score = 5.19883 sequence = CCTATCTTGTTTTAAGATTGT Gene: Desal_3365: membrane protein, putative Gene: Desal_0582: membrane protein, putative |
*
Desulfovibrio vulgaris Hildenborough Site: position = -85 score = 5.73734 sequence = TCCATCTGTTTTTCAGATAGA Site: position = -52 score = 5.12407 sequence = TCAATCCGTCTTCCAGATAGA Gene: DVU0308: membrane protein, putative |
|
|
membrane protein, putative |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |