Regulon of DVU0309 in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_0355
Regulator family:	LysR
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0309 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - LysR

Regulated operons
	Locus Tag	Name	Function
Position: -184 Score: 5.3 Sequence: CCTATCAGAAATTTTGATAGC Locus tag: Dret_0354 Name: null Funciton: peptidase M24
	Dret_0354		peptidase M24
Position: -418 Score: 5.3 Sequence: GCTATCAAAATTTCTGATAGG Locus tag: Dret_0355 Name: null Funciton: transcriptional regulator, LysR family
	Dret_0355		transcriptional regulator, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD