Regulon of DVU0309 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_3366
Regulator family:	LysR
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0309 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - LysR

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 5.2 Sequence: CCTATCTTGTTTTAAGATTGT Position: -52 Score: 5 Sequence: CCAAACTGAATAAAAGATTGA Locus tag: Desal_3365 Name: COG4125 Funciton: membrane protein, putative
	Desal_3365	COG4125	membrane protein, putative
Position: -63 Score: 5 Sequence: TCAATCTTTTATTCAGTTTGG Position: -31 Score: 5.2 Sequence: ACAATCTTAAAACAAGATAGG Locus tag: Desal_3366 Name: null Funciton: transcriptional regulator, LysR family
	Desal_3366		transcriptional regulator, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD