Regulon of DVU0309 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0309
Regulator family:	LysR
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0309 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - LysR

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5.7 Sequence: TCCATCTGTTTTTCAGATAGA Position: -52 Score: 5.1 Sequence: TCAATCCGTCTTCCAGATAGA Locus tag: DVU0308 Name: COG4125 Funciton: membrane protein, putative
	DVU0308	COG4125	membrane protein, putative
Position: -61 Score: 5.1 Sequence: TCTATCTGGAAGACGGATTGA Position: -28 Score: 5.7 Sequence: TCTATCTGAAAAACAGATGGA Locus tag: DVU0309 Name: null Funciton: transcriptional regulator, LysR family
	DVU0309		transcriptional regulator, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD