Regulog TunR2 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | TunR |
| Regulation mode: | activator |
| Biological process: | Molybdenum homeostasis; Metabolite transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TunR
- By pathway - Molybdenum homeostasis
- By pathway - Metabolite transport
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | 1 | 1 |
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | 5 | 5 |
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio vulgaris Hildenborough | 2 | 2 |
| Desulfovibrio vulgaris str. Miyazaki F | 2 | 2 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| mop |
|
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -121 score = 5.70826 sequence = CTAACACGAAAAAATTAATTTGCGTGTGAG Gene: DMR_17150: molybdenum-pterin binding protein |
|
|
|
|
|
molybdenum-pterin binding protein |
| CRON 2. | |||||||||||
| DMR_20140 |
Gene: Dret_0055: SulP family transporter |
|
Gene: Dde_2855: SulP family transporter |
|
*
Desulfovibrio magneticus RS-1 Site: position = -85 score = 5.764 sequence = GTAACACGTATTTTCTAAAATCCGTGTCAT Gene: DMR_20140: SulP family transporter |
|
Gene: Desal_0899: SulP family transporter |
|
|
|
SulP family transporter |
| CRON 3. | |||||||||||
| DVU0770 |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -114 score = 6.27202 sequence = GTGACACGATAAAAATTAAAAAAATGTCTT Gene: Dbac_2091: TSUP family transporter |
|
Gene: Ddes_0089: TSUP family transporter |
*
Desulfovibrio magneticus RS-1 Site: position = -49 score = 5.89755 sequence = CTGACACGTATATTATAAAACCGGTGTGAG Gene: DMR_43930: TSUP family transporter |
Gene: DESPIG_01961: TSUP family transporter |
|
*
Desulfovibrio vulgaris Hildenborough Site: position = -50 score = 5.66121 sequence = CTGACACGATACATGATATTTTCGTGCCTC Gene: DVU0770: TSUP family transporter |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -213 score = 6.11787 sequence = CAGGCATGAAAATAAAATAATCCGTGACAA Site: position = -157 score = 7.46752 sequence = TTGACACGAAGATTATAAAAAACGTGTCAG Gene: DvMF_2812: TSUP family transporter |
Gene: LI0911: TSUP family transporter |
TSUP family transporter |
| CRON 4. | |||||||||||
| DMR_43460 |
Gene: Dret_2266: COG1720: Uncharacterized conserved protein |
Gene: Dbac_1889: COG1720: Uncharacterized conserved protein |
Gene: Dde_2646: COG1720: Uncharacterized conserved protein |
|
*2
Desulfovibrio magneticus RS-1 Site: position = -159 score = 5.24242 sequence = CTGGCACGGCAATCCTAAAAGCCGTGTCTT Gene: DMR_43460: COG1720: Uncharacterized conserved protein Gene: DMR_04300: COG1720: Uncharacterized conserved protein |
|
Gene: Desal_1921: COG1720: Uncharacterized conserved protein |
|
Gene: DvMF_2475: COG1720: Uncharacterized conserved protein |
|
COG1720: Uncharacterized conserved protein |
| CRON 5. | |||||||||||
| DMR_43920 |
Gene: Dret_2394: putative molybdenum storage protein |
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -23 score = 5.17172 sequence = CTCACACCGGTTTTATAATATACGTGTCAG Gene: DMR_43920: putative molybdenum storage protein |
|
Gene: Desal_0900: putative molybdenum storage protein |
|
|
|
putative molybdenum storage protein |
| CRON 6. | |||||||||||
| tunR2 |
|
|
|
|
|
|
|
*
Desulfovibrio vulgaris Hildenborough Site: position = -134 score = 5.69956 sequence = GAGGCACGAAAATATCATGTATCGTGTCAG Gene: DVU0771: Putative transcriptional regulator of molybdate/tungsten homeostasis, TunR family |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -242 score = 4.62458 sequence = TTGTCACGGATTATTTTATTTTCATGCCTG Site: position = -298 score = 5.83678 sequence = CTGACACGTTTTTTATAATCTTCGTGTCAA Gene: DvMF_2813: Putative transcriptional regulator of molybdate/tungsten homeostasis, TunR family |
|
Putative transcriptional regulator of molybdate/tungsten homeostasis, TunR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |