Regulon of TunR2 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0771
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Molybdenum homeostasis; Metabolite transport
Effector:
Regulog:	TunR2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By pathway - Molybdenum homeostasis
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.7 Sequence: CTGACACGATACATGATATTTTCGTGCCTC Locus tag: DVU0770 Name: null Funciton: TSUP family transporter
	DVU0770		TSUP family transporter
Position: -134 Score: 5.7 Sequence: GAGGCACGAAAATATCATGTATCGTGTCAG Locus tag: DVU0771 Name: tunR2 Funciton: Putative transcriptional regulator of molybdate/tungsten homeostasis, TunR family
	DVU0771	tunR2	Putative transcriptional regulator of molybdate/tungsten homeostasis, TunR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD