Regulon of TunR2 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_3411
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Molybdenum homeostasis; Metabolite transport
Effector:
Regulog:	TunR2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By pathway - Molybdenum homeostasis
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 6.3 Sequence: GTGACACGATAAAAATTAAAAAAATGTCTT Locus tag: Dbac_2091 Name: null Funciton: TSUP family transporter
	Dbac_2091		TSUP family transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD