Regulon of TunR2 in Desulfovibrio magneticus RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	DMR_06550
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Molybdenum homeostasis; Metabolite transport
Effector:
Regulog:	TunR2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	5
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By pathway - Molybdenum homeostasis
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.9 Sequence: CTGACACGTATATTATAAAACCGGTGTGAG Locus tag: DMR_43930 Name: null Funciton: TSUP family transporter
	DMR_43930		TSUP family transporter
Position: -121 Score: 5.7 Sequence: CTAACACGAAAAAATTAATTTGCGTGTGAG Locus tag: DMR_17150 Name: mop Funciton: molybdenum-pterin binding protein
	DMR_17150	mop	molybdenum-pterin binding protein
Position: -85 Score: 5.8 Sequence: GTAACACGTATTTTCTAAAATCCGTGTCAT Locus tag: DMR_20140 Name: null Funciton: SulP family transporter
	DMR_20140		SulP family transporter
Position: -23 Score: 5.2 Sequence: CTCACACCGGTTTTATAATATACGTGTCAG Locus tag: DMR_43920 Name: null Funciton: putative molybdenum storage protein
	DMR_43920		putative molybdenum storage protein
Position: -159 Score: 5.2 Sequence: CTGGCACGGCAATCCTAAAAGCCGTGTCTT Locus tag: DMR_43460 Name: null Funciton: COG1720: Uncharacterized conserved protein
	DMR_43460		COG1720: Uncharacterized conserved protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD