Statistics of regulated genes

Genome	Genes	Operons
Clostridium hiranonis DSM 13275	4	2
Clostridium difficile 630	5	2
Clostridium bartlettii DSM 16795	7	3

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes				Function
CRON 1.
groES	* Clostridium hiranonis DSM 13275 Site: position = -84 score = 7.52423 sequence = TTAGCACTCATAGTCTTAGAGTGCTAA Gene: CLOHIR_00054: Heat shock protein 60 family co-chaperone GroES	* Clostridium difficile 630 Site: position = -136 score = 7.06392 sequence = TTAGCACTCTATTAGATAGAGTGATAA Gene: CD0193: Heat shock protein 60 family co-chaperone GroES	* Clostridium bartlettii DSM 16795 Site: position = -93 score = 7.35859 sequence = TTAGCACTCTTACTTAAAGAGTGATAA Gene: CLOBAR_00663: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groEL	Clostridium hiranonis DSM 13275 Gene: CLOHIR_00055: Heat shock protein 60 family chaperone GroEL	Clostridium difficile 630 Gene: CD0194: Heat shock protein 60 family chaperone GroEL	Clostridium bartlettii DSM 16795 Gene: CLOBAR_00662: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL
CRON 2.
hrcA	* Clostridium hiranonis DSM 13275 Site: position = -42 score = 7.39933 sequence = TTAGCACTCTTAAACGATGAGTGCTAA Gene: CLOHIR_02043: Heat-inducible transcription repressor HrcA	* Clostridium difficile 630 Site: position = -47 score = 7.20945 sequence = TTAGCACTCGAACTTAGTGAGTGCTAA Gene: CD2463: Heat-inducible transcription repressor HrcA	* Clostridium bartlettii DSM 16795 Site: position = -20 score = 7.34182 sequence = TTAGCACTCGAAAATAGTGAGTGCTAA Gene: CLOBAR_02734: Heat-inducible transcription repressor HrcA	Heat-inducible transcription repressor HrcA
grpE	Clostridium hiranonis DSM 13275 Gene: CLOHIR_02044: Heat shock protein GrpE	Clostridium difficile 630 Gene: CD2462: Heat shock protein GrpE	Clostridium bartlettii DSM 16795 Gene: CLOBAR_02733: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Clostridium hiranonis DSM 13275	Clostridium difficile 630 Gene: CD2461: Chaperone protein DnaK	Clostridium bartlettii DSM 16795 Gene: CLOBAR_02732: Chaperone protein DnaK	Chaperone protein DnaK
CRON 3.
COG0071	Clostridium hiranonis DSM 13275	Clostridium difficile 630	*2 Clostridium bartlettii DSM 16795 Gene: CLOBAR_00614: Molecular chaperone (small heat shock protein) Site: position = -233 score = 6.79031 sequence = TTAGCACTCTCCTATTGACAGTGCTAA Site: position = -52 score = 7.44222 sequence = TTAGCACTCGATAACTTAGAGTGCTAA Gene: CLOBAR_00615: Molecular chaperone (small heat shock protein)	Molecular chaperone (small heat shock protein)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD