Regulog HrcA - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Clostridium hiranonis DSM 13275 | 4 | 2 |
| Clostridium difficile 630 | 5 | 2 |
| Clostridium bartlettii DSM 16795 | 7 | 3 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| groES |
*
Clostridium hiranonis DSM 13275 Site: position = -84 score = 7.52423 sequence = TTAGCACTCATAGTCTTAGAGTGCTAA Gene: CLOHIR_00054: Heat shock protein 60 family co-chaperone GroES |
*
Clostridium difficile 630 Site: position = -136 score = 7.06392 sequence = TTAGCACTCTATTAGATAGAGTGATAA Gene: CD0193: Heat shock protein 60 family co-chaperone GroES |
*
Clostridium bartlettii DSM 16795 Site: position = -93 score = 7.35859 sequence = TTAGCACTCTTACTTAAAGAGTGATAA Gene: CLOBAR_00663: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groEL |
Gene: CLOHIR_00055: Heat shock protein 60 family chaperone GroEL |
Gene: CD0194: Heat shock protein 60 family chaperone GroEL |
Gene: CLOBAR_00662: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 2. | ||||
| hrcA |
*
Clostridium hiranonis DSM 13275 Site: position = -42 score = 7.39933 sequence = TTAGCACTCTTAAACGATGAGTGCTAA Gene: CLOHIR_02043: Heat-inducible transcription repressor HrcA |
*
Clostridium difficile 630 Site: position = -47 score = 7.20945 sequence = TTAGCACTCGAACTTAGTGAGTGCTAA Gene: CD2463: Heat-inducible transcription repressor HrcA |
*
Clostridium bartlettii DSM 16795 Site: position = -20 score = 7.34182 sequence = TTAGCACTCGAAAATAGTGAGTGCTAA Gene: CLOBAR_02734: Heat-inducible transcription repressor HrcA |
Heat-inducible transcription repressor HrcA |
| grpE |
Gene: CLOHIR_02044: Heat shock protein GrpE |
Gene: CD2462: Heat shock protein GrpE |
Gene: CLOBAR_02733: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
|
Gene: CD2461: Chaperone protein DnaK |
Gene: CLOBAR_02732: Chaperone protein DnaK |
Chaperone protein DnaK |
| CRON 3. | ||||
| COG0071 |
|
|
*2
Clostridium bartlettii DSM 16795 Gene: CLOBAR_00614: Molecular chaperone (small heat shock protein) Site: position = -233 score = 6.79031 sequence = TTAGCACTCTCCTATTGACAGTGCTAA Site: position = -52 score = 7.44222 sequence = TTAGCACTCGATAACTTAGAGTGCTAA Gene: CLOBAR_00615: Molecular chaperone (small heat shock protein) |
Molecular chaperone (small heat shock protein) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |