Regulon of HrcA in Clostridium bartlettii DSM 16795

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOBAR_02734
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-2
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -233 Score: 6.8 Sequence: TTAGCACTCTCCTATTGACAGTGCTAA Position: -52 Score: 7.4 Sequence: TTAGCACTCGATAACTTAGAGTGCTAA Locus tag: CLOBAR_00615 Name: COG0071 Funciton: Molecular chaperone (small heat shock protein) Locus tag: CLOBAR_00614 Name: COG0071 Funciton: Molecular chaperone (small heat shock protein)
	CLOBAR_00615	COG0071	Molecular chaperone (small heat shock protein)
	CLOBAR_00614	COG0071	Molecular chaperone (small heat shock protein)
Position: -20 Score: 7.3 Sequence: TTAGCACTCGAAAATAGTGAGTGCTAA Locus tag: CLOBAR_02734 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CLOBAR_02733 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CLOBAR_02732 Name: dnaK Funciton: Chaperone protein DnaK
	CLOBAR_02734	hrcA	Heat-inducible transcription repressor HrcA
	CLOBAR_02733	grpE	Heat shock protein GrpE
	CLOBAR_02732	dnaK	Chaperone protein DnaK
Position: -93 Score: 7.4 Sequence: TTAGCACTCTTACTTAAAGAGTGATAA Locus tag: CLOBAR_00663 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CLOBAR_00662 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CLOBAR_00663	groES	Heat shock protein 60 family co-chaperone GroES
	CLOBAR_00662	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD