Regulon of HrcA in Clostridium hiranonis DSM 13275

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOHIR_02043
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-2
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 7.4 Sequence: TTAGCACTCTTAAACGATGAGTGCTAA Locus tag: CLOHIR_02043 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CLOHIR_02044 Name: grpE Funciton: Heat shock protein GrpE
	CLOHIR_02043	hrcA	Heat-inducible transcription repressor HrcA
	CLOHIR_02044	grpE	Heat shock protein GrpE
Position: -84 Score: 7.5 Sequence: TTAGCACTCATAGTCTTAGAGTGCTAA Locus tag: CLOHIR_00054 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CLOHIR_00055 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CLOHIR_00054	groES	Heat shock protein 60 family co-chaperone GroES
	CLOHIR_00055	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD