Regulon of HrcA in Clostridium difficile 630

Properties
Regulator type:	Transcription factor
TF locus tag:	CD2463
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-2
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.2 Sequence: TTAGCACTCGAACTTAGTGAGTGCTAA Locus tag: CD2463 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CD2462 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CD2461 Name: dnaK Funciton: Chaperone protein DnaK
	CD2463	hrcA	Heat-inducible transcription repressor HrcA
	CD2462	grpE	Heat shock protein GrpE
	CD2461	dnaK	Chaperone protein DnaK
Position: -136 Score: 7.1 Sequence: TTAGCACTCTATTAGATAGAGTGATAA Locus tag: CD0193 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CD0194 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CD0193	groES	Heat shock protein 60 family co-chaperone GroES
	CD0194	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD