Regulog CzcR2 - Lactobacillaceae

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By pathway - Zinc resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
Genome | Genes | Operons |
---|---|---|
Lactobacillus acidophilus NCFM | ||
Lactobacillus brevis ATCC 367 | 2 | 2 |
Lactobacillus casei ATCC 334 | ||
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
Lactobacillus fermentum IFO 3956 | ||
Lactobacillus helveticus DPC 4571 | ||
Lactobacillus johnsonii NCC 533 | ||
Lactobacillus plantarum WCFS1 | ||
Lactobacillus reuteri JCM 1112 | ||
Lactobacillus rhamnosus GG | 2 | 1 |
Lactobacillus sakei subsp. sakei 23K | ||
Lactobacillus salivarius subsp. salivarius UCC118 | ||
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
Oenococcus oeni PSU-1 | ||
Pediococcus pentosaceus ATCC 25745 | 2 | 2 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
czcX |
|
|
|
|
|
|
|
|
|
*
Lactobacillus rhamnosus GG Site: position = -68 score = 5.98704 sequence = TTATGTTGACATTAACATAT Gene: LGG_02417: Predicted cobalt-zinc-cadmium resistance protein |
|
|
|
|
|
Predicted cobalt-zinc-cadmium resistance protein |
czcR2 |
|
*
Lactobacillus brevis ATCC 367 Site: position = -40 score = 5.93834 sequence = ATATGTTATCATATTCATAT Site: position = -56 score = 6.06647 sequence = ATATGTTATTTTCAACATAT Gene: LVIS_0395: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family |
|
|
|
|
|
|
|
Gene: LGG_02418: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family |
|
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -34 score = 6.06041 sequence = ATATGATAACATATTCATAT Gene: PEPE_0028: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family |
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family |
CRON 2. | ||||||||||||||||
cadD2 |
|
*
Lactobacillus brevis ATCC 367 Site: position = 14 score = 6.06647 sequence = ATATGTTGAAAATAACATAT Site: position = -2 score = 5.93834 sequence = ATATGAATATGATAACATAT Gene: LVIS_0396: Predicted permease, cadmium resistance protein |
|
|
Gene: LAF_0789: Predicted permease, cadmium resistance protein |
|
|
|
|
|
|
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -51 score = 6.06041 sequence = ATATGAATATGTTATCATAT Gene: PEPE_0029: Predicted permease, cadmium resistance protein |
Predicted permease, cadmium resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |