Regulon of CzcR2 in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0028
Regulator family:	ArsR
Regulation mode:
Biological process:	Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog:	CzcR2 - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - CzrA
By TF family - ArsR
By pathway - Zinc resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.1 Sequence: ATATGAATATGTTATCATAT Locus tag: PEPE_0029 Name: cadD2 Funciton: Predicted permease, cadmium resistance protein
	PEPE_0029	cadD2	Predicted permease, cadmium resistance protein
Position: -34 Score: 6.1 Sequence: ATATGATAACATATTCATAT Locus tag: PEPE_0028 Name: czcR2 Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
	PEPE_0028	czcR2	Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD