Regulon of CzcR2 in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_02418
Regulator family:	ArsR
Regulation mode:
Biological process:	Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog:	CzcR2 - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - CzrA
By TF family - ArsR
By pathway - Zinc resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6 Sequence: TTATGTTGACATTAACATAT Locus tag: LGG_02417 Name: czcX Funciton: Predicted cobalt-zinc-cadmium resistance protein Locus tag: LGG_02418 Name: czcR2 Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
	LGG_02417	czcX	Predicted cobalt-zinc-cadmium resistance protein
	LGG_02418	czcR2	Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD