Statistics of regulated genes

Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	2	1
Lactococcus lactis subsp. lactis Il1403	2	1
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36	2	1
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
busA	* Lactococcus lactis subsp. cremoris SK11 Site: position = -155 score = 7.89314 sequence = AGTGACTACATATTGTTATTATTGAGTGGTCACT Gene: LACR_1542: Glycine betaine ABC transporter, ATP-binding protein	* Lactococcus lactis subsp. lactis Il1403 Site: position = -155 score = 7.89314 sequence = AGTGACTACATATTGTTATTATTGAGTGGTCACT Gene: L74195: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus agalactiae 2603V/R Gene: SAG1797: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_2004: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0177: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1063: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy0183: Glycine betaine ABC transporter, ATP-binding protein	* Streptococcus sanguinis SK36 Site: position = -55 score = 7.71385 sequence = AGTGACAACTCATTAAAATAAAAATGTAGTCACT Gene: SSA_0386: Glycine betaine ABC transporter, ATP-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB1718: Glycine betaine ABC transporter, ATP-binding protein	Glycine betaine ABC transporter, ATP-binding protein
busB	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1541: Glycine betaine ABC transporter system, substrate binding and permease protein	Lactococcus lactis subsp. lactis Il1403 Gene: L72477: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus agalactiae 2603V/R Gene: SAG1796: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_2003: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0178: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1062: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy0184: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus sanguinis SK36 Gene: SSA_0385: Glycine betaine ABC transporter system, substrate binding and permease protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB1717: Glycine betaine ABC transporter system, substrate binding and permease protein	Glycine betaine ABC transporter system, substrate binding and permease protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD