Regulon of BusR in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_0387
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Betaine utilization
Effector:	Betaine
Regulog:	BusR - Streptococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By effector - Betaine
By pathway - Betaine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 7.7 Sequence: AGTGACAACTCATTAAAATAAAAATGTAGTCACT Locus tag: SSA_0386 Name: busA Funciton: Glycine betaine ABC transporter, ATP-binding protein Locus tag: SSA_0385 Name: busB Funciton: Glycine betaine ABC transporter system, substrate binding and permease protein
	SSA_0386	busA	Glycine betaine ABC transporter, ATP-binding protein
	SSA_0385	busB	Glycine betaine ABC transporter system, substrate binding and permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD