Regulon of BusR in Lactococcus lactis subsp. lactis Il1403
| Regulator type: | Transcription factor |
| TF locus tag: | L75633 |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Betaine utilization |
| Effector: | Betaine |
| Regulog: | BusR - Streptococcaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - GntR/Others
- By effector - Betaine
- By pathway - Betaine utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -155
Score: 7.9 Sequence: AGTGACTACATATTGTTATTATTGAGTGGTCACT
Locus tag: L74195
Name: busA Funciton: Glycine betaine ABC transporter, ATP-binding protein
Locus tag: L72477
Name: busB Funciton: Glycine betaine ABC transporter system, substrate binding and permease protein |
|||
|
busA
|
Glycine betaine ABC transporter, ATP-binding protein
|
||
|
busB
|
Glycine betaine ABC transporter system, substrate binding and permease protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |