Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of BusR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_1543
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Betaine utilization
Effector: Betaine
Regulog: BusR - Streptococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -155
Score: 7.9
Sequence: AGTGACTACATATTGTTATTATTGAGTGGTCACT
Locus tag: LACR_1542
Name: busA
Funciton: Glycine betaine ABC transporter, ATP-binding protein
Locus tag: LACR_1541
Name: busB
Funciton: Glycine betaine ABC transporter system, substrate binding and permease protein
busA
Glycine betaine ABC transporter, ATP-binding protein
busB
Glycine betaine ABC transporter system, substrate binding and permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD