Regulog YwzG - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Transport
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - PadR
By pathway - Transport

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367	3	1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1	3	1
Lactobacillus reuteri JCM 1112	3	1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118	4	1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	3	1
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
ywzG	Lactobacillus acidophilus NCFM	* Lactobacillus brevis ATCC 367 Site: position = -36 score = 7.05067 sequence = ATATTATACGTCGTATAGTAT Gene: LVIS_0242: Predicted transcriptional regulator, PadR family	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_0572: Predicted transcriptional regulator, PadR family	Lactobacillus johnsonii NCC 533	* Lactobacillus plantarum WCFS1 Site: position = -37 score = 7.05067 sequence = ATACTATACGACGTATAATAT Gene: lp_3216: Predicted transcriptional regulator, PadR family	* Lactobacillus reuteri JCM 1112 Site: position = -44 score = 7.20334 sequence = ATATTATATGACATATAATAT Gene: LAR_0307: Predicted transcriptional regulator, PadR family	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -59 score = 6.88491 sequence = ATATTATATGATATATAATAT Gene: LSL_0105: Predicted transcriptional regulator, PadR family	* Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -35 score = 7.10156 sequence = ATATTATATGTCGTATAGTAT Gene: LEUM_2026: Predicted transcriptional regulator, PadR family	Oenococcus oeni PSU-1	* Pediococcus pentosaceus ATCC 25745 Site: position = -36 score = 6.78313 sequence = ATACTATATGAGATATAGTAT Gene: PEPE_1823: Predicted transcriptional regulator, PadR family	Predicted transcriptional regulator, PadR family
lp_3217	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0243: Predicted integral membrane protein	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_3217: Predicted integral membrane protein	Lactobacillus reuteri JCM 1112 Gene: LAR_0308: Predicted integral membrane protein	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0106: Predicted integral membrane protein	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_2025: Predicted integral membrane protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1824: Predicted integral membrane protein	Predicted integral membrane protein
lp_3218	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0244: Conserved hypothetical protein	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_3218: Conserved hypothetical protein	Lactobacillus reuteri JCM 1112 Gene: LAR_0309: Conserved hypothetical protein	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0107: Conserved hypothetical protein	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_2024: Conserved hypothetical protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1825: Conserved hypothetical protein	Conserved hypothetical protein
COG1983	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0108: Putative stress-responsive transcriptional regulator	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Putative stress-responsive transcriptional regulator

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YwzG - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --