Regulog YwzG - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Transport |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - PadR
- By pathway - Transport
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 3 | 1 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 3 | 1 |
| Lactobacillus reuteri JCM 1112 | 3 | 1 |
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | 4 | 1 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 3 | 1 |
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 3 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| ywzG |
|
*
Lactobacillus brevis ATCC 367 Site: position = -36 score = 7.05067 sequence = ATATTATACGTCGTATAGTAT Gene: LVIS_0242: Predicted transcriptional regulator, PadR family |
|
|
|
Gene: lhv_0572: Predicted transcriptional regulator, PadR family |
|
*
Lactobacillus plantarum WCFS1 Site: position = -37 score = 7.05067 sequence = ATACTATACGACGTATAATAT Gene: lp_3216: Predicted transcriptional regulator, PadR family |
*
Lactobacillus reuteri JCM 1112 Site: position = -44 score = 7.20334 sequence = ATATTATATGACATATAATAT Gene: LAR_0307: Predicted transcriptional regulator, PadR family |
|
|
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -59 score = 6.88491 sequence = ATATTATATGATATATAATAT Gene: LSL_0105: Predicted transcriptional regulator, PadR family |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -35 score = 7.10156 sequence = ATATTATATGTCGTATAGTAT Gene: LEUM_2026: Predicted transcriptional regulator, PadR family |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -36 score = 6.78313 sequence = ATACTATATGAGATATAGTAT Gene: PEPE_1823: Predicted transcriptional regulator, PadR family |
Predicted transcriptional regulator, PadR family |
| lp_3217 |
|
Gene: LVIS_0243: Predicted integral membrane protein |
|
|
|
|
|
Gene: lp_3217: Predicted integral membrane protein |
Gene: LAR_0308: Predicted integral membrane protein |
|
|
Gene: LSL_0106: Predicted integral membrane protein |
Gene: LEUM_2025: Predicted integral membrane protein |
|
Gene: PEPE_1824: Predicted integral membrane protein |
Predicted integral membrane protein |
| lp_3218 |
|
Gene: LVIS_0244: Conserved hypothetical protein |
|
|
|
|
|
Gene: lp_3218: Conserved hypothetical protein |
Gene: LAR_0309: Conserved hypothetical protein |
|
|
Gene: LSL_0107: Conserved hypothetical protein |
Gene: LEUM_2024: Conserved hypothetical protein |
|
Gene: PEPE_1825: Conserved hypothetical protein |
Conserved hypothetical protein |
| COG1983 |
|
|
|
|
|
|
|
|
|
|
|
Gene: LSL_0108: Putative stress-responsive transcriptional regulator |
|
|
|
Putative stress-responsive transcriptional regulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |