Regulon of YwzG in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_0105
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	YwzG - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - PadR
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.9 Sequence: ATATTATATGATATATAATAT Locus tag: LSL_0105 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LSL_0106 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LSL_0107 Name: lp_3218 Funciton: Conserved hypothetical protein Locus tag: LSL_0108 Name: COG1983 Funciton: Putative stress-responsive transcriptional regulator
	LSL_0105	ywzG	Predicted transcriptional regulator, PadR family
	LSL_0106	lp_3217	Predicted integral membrane protein
	LSL_0107	lp_3218	Conserved hypothetical protein
	LSL_0108	COG1983	Putative stress-responsive transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD