Regulon of YwzG in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_2026
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	YwzG - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - PadR
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 7.1 Sequence: ATATTATATGTCGTATAGTAT Locus tag: LEUM_2026 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LEUM_2025 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LEUM_2024 Name: lp_3218 Funciton: Conserved hypothetical protein
	LEUM_2026	ywzG	Predicted transcriptional regulator, PadR family
	LEUM_2025	lp_3217	Predicted integral membrane protein
	LEUM_2024	lp_3218	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD