Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1983 gene

Properties
Regulog: YwzG - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus salivarius subsp. salivarius UCC118
Position: -59
Score: 6.88491
Sequence: ATATTATATGATATATAATAT
Locus tag: LSL_0105
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LSL_0106
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LSL_0107
Name: lp_3218
Funciton: Conserved hypothetical protein
Locus tag: LSL_0108
Name: COG1983
Funciton: Putative stress-responsive transcriptional regulator
ywzG-lp_3217-lp_3218-COG1983 -59 6.9 ATATTATATGATATATAATAT LSL_0105
© 2009-2020 RegPrecise