Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lp_3217 gene

Properties
Regulog: YwzG - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -36
Score: 7.05067
Sequence: ATATTATACGTCGTATAGTAT
Locus tag: LVIS_0242
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LVIS_0243
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LVIS_0244
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218 -36 7.1 ATATTATACGTCGTATAGTAT LVIS_0242
Lactobacillus plantarum WCFS1
Position: -37
Score: 7.05067
Sequence: ATACTATACGACGTATAATAT
Locus tag: lp_3216
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: lp_3217
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: lp_3218
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218 -37 7.1 ATACTATACGACGTATAATAT lp_3216
Lactobacillus reuteri JCM 1112
Position: -44
Score: 7.20334
Sequence: ATATTATATGACATATAATAT
Locus tag: LAR_0307
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LAR_0308
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LAR_0309
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218 -44 7.2 ATATTATATGACATATAATAT LAR_0307
Lactobacillus salivarius subsp. salivarius UCC118
Position: -59
Score: 6.88491
Sequence: ATATTATATGATATATAATAT
Locus tag: LSL_0105
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LSL_0106
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LSL_0107
Name: lp_3218
Funciton: Conserved hypothetical protein
Locus tag: LSL_0108
Name: COG1983
Funciton: Putative stress-responsive transcriptional regulator
ywzG-lp_3217-lp_3218-COG1983 -59 6.9 ATATTATATGATATATAATAT LSL_0105
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Position: -35
Score: 7.10156
Sequence: ATATTATATGTCGTATAGTAT
Locus tag: LEUM_2026
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LEUM_2025
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LEUM_2024
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218 -35 7.1 ATATTATATGTCGTATAGTAT LEUM_2026
Pediococcus pentosaceus ATCC 25745
Position: -36
Score: 6.78313
Sequence: ATACTATATGAGATATAGTAT
Locus tag: PEPE_1823
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: PEPE_1824
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: PEPE_1825
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218 -36 6.8 ATACTATATGAGATATAGTAT PEPE_1823