Regulog NrfR - Bacteroidaceae

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Phylum:	Bacteroidetes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - CRP
By effector - Nitrite
By pathway - Nitrate and nitrite respiration

Statistics of regulated genes
Genome	Genes	Operons
Bacteroides cellulosilyticus DSM 14838	3	1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855
Bacteroides eggerthii DSM 20697
Bacteroides fragilis NCTC 9343	6	1
Bacteroides ovatus ATCC 8483	5	1
Bacteroides plebeius DSM 17135	5	1
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482	5	1
Bacteroides uniformis ATCC 8492	5	1
Bacteroides vulgatus ATCC 8482

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
nrfH	* Bacteroides cellulosilyticus DSM 14838 Site: position = -65 score = 6.58022 sequence = GATGTAATCATTATTACACT Gene: BACCELL_02840: Cytochrome c nitrite reductase, small subunit NrfH	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	* Bacteroides fragilis NCTC 9343 Site: position = -73 score = 6.13525 sequence = AATGTAATCTGGATTACATC Gene: BF0360: Cytochrome c nitrite reductase, small subunit NrfH	* Bacteroides ovatus ATCC 8483 Site: position = -65 score = 6.42757 sequence = GGTGTAATAGATATTACACC Gene: BACOVA_00831: Cytochrome c nitrite reductase, small subunit NrfH	* Bacteroides plebeius DSM 17135 Site: position = 27 score = 6.01401 sequence = GGTGTCATATTTATTACACC Gene: BACPLE_01440: Cytochrome c nitrite reductase, small subunit NrfH	Bacteroides stercoris ATCC 43183	* Bacteroides thetaiotaomicron VPI-5482 Site: position = -66 score = 6.57031 sequence = GGTGTAATAGTTATTACACC Gene: BT1418: Cytochrome c nitrite reductase, small subunit NrfH	* Bacteroides uniformis ATCC 8492 Site: position = -64 score = 6.5138 sequence = AATGTAATCATGATTACACT Gene: BACUNI_04432: Cytochrome c nitrite reductase, small subunit NrfH	Bacteroides vulgatus ATCC 8482	Cytochrome c nitrite reductase, small subunit NrfH
nrfA	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_02841: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343 Gene: BF0361: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides ovatus ATCC 8483 Gene: BACOVA_00830: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides plebeius DSM 17135 Gene: BACPLE_01441: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT1417: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides uniformis ATCC 8492 Gene: BACUNI_04431: Cytochrome c552 precursor (EC 1.7.2.2)	Bacteroides vulgatus ATCC 8482	Cytochrome c552 precursor (EC 1.7.2.2)
nrfI	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_02842: Cytochrome c biogenesis protein	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343 Gene: BF0362: Cytochrome c biogenesis protein	Bacteroides ovatus ATCC 8483 Gene: BACOVA_00829: Cytochrome c biogenesis protein	Bacteroides plebeius DSM 17135 Gene: BACPLE_01442: Cytochrome c biogenesis protein	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT1416: Cytochrome c biogenesis protein	Bacteroides uniformis ATCC 8492 Gene: BACUNI_04430: Cytochrome c biogenesis protein	Bacteroides vulgatus ATCC 8482	Cytochrome c biogenesis protein
nrfE	2 Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05716: Cytochrome c biogenesis protein Gene: BACCELL_02843: Cytochrome c biogenesis protein	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343 Gene: BF0363: Cytochrome c biogenesis protein	Bacteroides ovatus ATCC 8483 Gene: BACOVA_00828: Cytochrome c biogenesis protein	Bacteroides plebeius DSM 17135 Gene: BACPLE_01443: Cytochrome c biogenesis protein	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT1415: Cytochrome c biogenesis protein	Bacteroides uniformis ATCC 8492 Gene: BACUNI_04429: Cytochrome c biogenesis protein	Bacteroides vulgatus ATCC 8482	Cytochrome c biogenesis protein
nrfP	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_02844: Predicted porin, associated with nitrate respiration	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343 Gene: BF0364: Predicted porin, associated with nitrate respiration	Bacteroides ovatus ATCC 8483 Gene: BACOVA_00827: Predicted porin, associated with nitrate respiration	Bacteroides plebeius DSM 17135 Gene: BACPLE_01444: Predicted porin, associated with nitrate respiration	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT1414: Predicted porin, associated with nitrate respiration	Bacteroides uniformis ATCC 8492 Gene: BACUNI_04428: Predicted porin, associated with nitrate respiration	Bacteroides vulgatus ATCC 8482	Predicted porin, associated with nitrate respiration
nrfR	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_02845: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343 Gene: BF0365: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides ovatus ATCC 8483 Gene: BACOVA_00819: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides plebeius DSM 17135 Gene: BACPLE_01445: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT1413: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides uniformis ATCC 8492 Gene: BACUNI_04427: Predicted transcriptional regulator of nitrite reductase, Crp family	Bacteroides vulgatus ATCC 8482	Predicted transcriptional regulator of nitrite reductase, Crp family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrfR - Bacteroidaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --