Regulon of NrfR in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_01445
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Regulog:	NrfR - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - CRP
By effector - Nitrite
By pathway - Nitrate and nitrite respiration

Regulated operons
	Locus Tag	Name	Function
Position: 27 Score: 6 Sequence: GGTGTCATATTTATTACACC Locus tag: BACPLE_01440 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BACPLE_01441 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BACPLE_01442 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BACPLE_01443 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BACPLE_01444 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
	BACPLE_01440	nrfH	Cytochrome c nitrite reductase, small subunit NrfH
	BACPLE_01441	nrfA	Cytochrome c552 precursor (EC 1.7.2.2)
	BACPLE_01442	nrfI	Cytochrome c biogenesis protein
	BACPLE_01443	nrfE	Cytochrome c biogenesis protein
	BACPLE_01444	nrfP	Predicted porin, associated with nitrate respiration

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD