Orthologous regulated operons containing nrfR gene

Properties
Regulog:	NrfR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Phylum:	Bacteroidetes

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides fragilis NCTC 9343
Position: -73 Score: 6.13525 Sequence: AATGTAATCTGGATTACATC Locus tag: BF0360 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BF0361 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BF0362 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BF0363 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BF0364 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration Locus tag: BF0365 Name: nrfR Funciton: Predicted transcriptional regulator of nitrite reductase, Crp family
nrfH-nrfA-nrfI-nrfE-nrfP-nrfR	-73	6.1	AATGTAATCTGGATTACATC	BF0360

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --